2. Search Result
Search Result
Results for "

(R)-3-Hydroxybutanoic acid (sodium)

" in MedChemExpress (MCE) Product Catalog:

3266

Inhibitors & Agonists

72

Fluorescent Dye

302

Biochemical Assay Reagents

1616

Peptides

1

Inhibitory Antibodies

505

Natural
Products

38

Isotope-Labeled Compounds

80

Click Chemistry

52

Oligonucleotides

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-W015851
    (R)-3-Hydroxybutanoic acid sodium
    5 Publications Verification

    (R)-(-)-3-Hydroxybutanoic acid sodium; (R)-3-Hydroxybutyric acid sodium

    		 Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid ((R)-3-Hydroxybutyric acid) sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones .
    (R)-3-Hydroxybutanoic acid sodium
  • HY-W051723
    (R)-3-Hydroxybutanoic acid
    5 Publications Verification

    (R)-(-)-3-Hydroxybutanoic acid; (R)-3-Hydroxybutyric acid

    		 Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones .
    (R)-3-Hydroxybutanoic acid
  • HY-W015851S2
    (R)-3-Hydroxybutanoic acid-13C4 sodium

    (R)-(-)-3-Hydroxybutanoic acid-13C4 sodium; (R)-3-Hydroxybutyric acid-13C4 sodium

    		 Isotope-Labeled Compounds Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid- 13C4 sodium is a 13C labeled (R)-3-Hydroxybutanoic acid (HY-W051723). (R)-3-Hydroxybutanoic acid is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones .
    (R)-3-Hydroxybutanoic acid-13C4 sodium
  • HY-B0228S10
    (R)-3-Hydroxybutanoic acid-13C2 sodium

    (R)-(-)-3-Hydroxybutanoic acid-13C2 sodium; (R)-3-Hydroxybutyric acid-13C2 sodium

    		 Isotope-Labeled Compounds Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid- 13C2 (sodium) is the 13C labeled (R)-3-Hydroxybutanoic acid (sodium) (HY-W015851). (R)-3-Hydroxybutanoic acid (sodium) is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones [3].
    (R)-3-Hydroxybutanoic acid-13C2 sodium
  • HY-W654002
    (3R)-3-Hydroxybutyric acid-1-13C

    		Isotope-Labeled Compounds Endogenous Metabolite Others
    (3R)-3-Hydroxybutyric acid-1- 13C is 13C labeled (R)-3-Hydroxybutanoic acid. (R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones [3].
    (3R)-3-Hydroxybutyric acid-1-13C
  • HY-P0041A
    F992 TFA

    		Vasopressin Receptor Neurological Disease
    F992 TFA is an antidiuretic peptide and vasopressin (antidiuretic hormone) analogue .
    F992 TFA
  • HY-W015851R
    (R)-3-Hydroxybutanoic acid sodium (Standard)

    (R)-(-)-3-Hydroxybutanoic acid sodium (Standard); (R)-3-Hydroxybutyric acid sodium (Standard)

    		 Reference Standards Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid (sodium) (Standard) is the analytical standard of (R)-3-Hydroxybutanoic acid (sodium). This product is intended for research and analytical applications. (R)-3-Hydroxybutanoic acid ((R)-3-Hydroxybutyric acid) sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones[1][2].
    (R)-3-Hydroxybutanoic acid sodium (Standard)
  • HY-W051723R
    (R)-3-Hydroxybutanoic acid (Standard)

    (R)-(-)-3-Hydroxybutanoic acid (Standard); (R)-3-Hydroxybutyric acid (Standard)

    		 Reference Standards Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid (Standard) is the analytical standard of (R)-3-Hydroxybutanoic acid. This product is intended for research and analytical applications. (R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones[1][2].
    (R)-3-Hydroxybutanoic acid (Standard)
  • HY-P0041
    F992

    		Vasopressin Receptor Neurological Disease
    F992 is an antidiuretic peptide and vasopressin (antidiuretic hormone) analogue .
    F992
  • HY-P10876
    mcK6A1

    		Amyloid-β Neurological Disease
    mcK6A1 is an inhibitor for the aggregation of amyloid-β (Aβ), that selectively binds to the 16KLVFFA21 segment of Aβ42, forms an extended β-folded structure, and inhibits the formation of Aβ42 oligomers. mcK6A1 can be used in research of Alzheimer's disease and other amyloid-related diseases .
    mcK6A1
  • HY-P10218A
    MANS peptide TFA

    		MARCKS PKC Inflammation/Immunology Cancer
    MANS peptide TFA is the TFA salt form of MANS peptide (HY-P10218). MANS peptide TFA is an inhibitor for myristoylated alanine-rich C kinase substrate (MARCKS), which competes with MARCKS in cells for membrane binding, and thus inhibits the stimulation of mucin secretion and tumor metastasis .
    MANS peptide TFA
  • HY-P10218
    MANS peptide

    		MARCKS PKC Inflammation/Immunology Cancer
    MANS peptide is an inhibitor for myristoylated alanine-rich C kinase substrate (MARCKS), which competes with MARCKS in cells for membrane binding, and thus inhibits the stimulation of mucin secretion and tumor metastasis .
    MANS peptide
  • HY-169089
    RP-182-PEG3-K(palmitic acid)

    		Drug Derivative Cancer
    RP-182-PEG3-K palmitic acid (Compound 1a) is a fatty acid derivative of the immunomodulatory peptide RP-182. RP-182-PEG3-K palmitic acid inhibits CD206 high M2-like macrophage (IC50 of 3.2 μM) and induces phagocytosis. RP-182-PEG3-K palmitic acid exhibits antitumor efficacy in mouse B16 melanoma allografts .
    RP-182-PEG3-K(palmitic acid)
  • HY-P10869
    dCNP

    		Natriuretic Peptide Receptor (NPR) Inflammation/Immunology Cancer
    dCNP binds to NPR-B/C receptor, activates cGMP signaling pathway, and regulates vascular function. dCNP exhibits anti-hypoxia property through downregulation of hypoxia-related genes expressions like HIF1α and HIF2α. dCNP inhibits the induction of tumor stroma and exhibits anti-fibrosis activity. dCNP upregulates CTLs, NK cells, and conventional type 1 dendritic cells in tumors, and activates immune responses .
    dCNP
  • HY-P10200
    CP7-FP13-2

    		Bacterial Infection
    CP7-FP13-2 is a peptide with antivirulence factor and antibacterial activity. CP7-FP13-2 inhibits the formation of Staphylococcus aureus biofilm and has good antibacterial efficacy in mice .
    CP7-FP13-2
  • HY-P10318
    SHR-2042

    		GLP Receptor Endocrinology
    SHR-2042 is a selective agonist of the GLP-1 receptor.SHR-2042 improves glycemic control by activating the GLP-1 receptor, enhancing insulin secretion and inhibiting glucagon secretion. SHR-2042 combined with sodium N-(8-[2-hydroxybenzoyl] amino) caprylate (SNAC) promotes monomerization through the formation of micelles and improves oral absorption efficiency .
    SHR-2042
  • HY-10585AG
    Valproic acid (sodium)

    Sodium Valproate (sodium)

    		 Organoid HDAC Autophagy Mitophagy HIV Notch Apoptosis Endogenous Metabolite Infection Neurological Disease Metabolic Disease Cancer
    Valproic acid (Sodium Valproate) sodium is an orally active HDAC inhibitor, with IC50 in the range of 0.5 and 2 mM, also inhibits HDAC1 (IC50, 400 μM), and induces proteasomal degradation of HDAC2. Valproic acid sodium activates Notch1 signaling and inhibits proliferation in small cell lung cancer (SCLC) cells. Valproic acid sodium is used in the treatment of epilepsy, bipolar disorder, metabolic disease, HIV infection and prevention of migraine headaches [3] .
    Valproic acid (sodium)
  • HY-P5161
    FC382K10W15

    		GLP Receptor GCGR Metabolic Disease
    FC382K10W15 is a glucagon analogue and GLP-1R/GCGR agonist. FC382K10W15 can be used in type 2 diabetes research .
    FC382K10W15
  • HY-P5161A
    FC382K10W15 TFA

    		GLP Receptor GCGR Metabolic Disease
    FC382K10W15 TFA is a glucagon analogue and GLP-1R/GCGR agonist. FC382K10W15 TFA can be used in type 2 diabetes research .
    FC382K10W15 TFA
  • HY-P3462
    Cagrilintide
    3 Publications Verification

    		 CGRP Receptor Metabolic Disease
    Cagrilintide is an investigational novel long-acting acylated amylin analogue, acts as nonselective amylin receptors (AMYR) and calcitonin G protein-coupled receptor (CTR) agonist. Cagrilintide induces significant weight loss and reduces food intake. Cagrilintide has the potential for the research of obesity [3].
    Cagrilintide
  • HY-P3462A
    Cagrilintide acetate
    3 Publications Verification

    		 CGRP Receptor Metabolic Disease
    Cagrilintide acetate is a non-selective AMYR/CTR agonist and long-acting acylated amylase analogue. Cagrilintide acetate causes a reduction in food intake and significant weight loss in a dose-dependent manner. Cagrilintide acetate can be used in obesity studies [3].
    Cagrilintide acetate
  • HY-P3143
    BMSpep-57

    		PD-1/PD-L1 Cancer
    BMSpep-57 is a potent and competitive macrocyclic peptide inhibitor of PD-1/PD-L1 interaction with an IC50 of 7.68 nM. BMSpep-57 binds to PD-L1 with Kds of 19 nM and 19.88 nM in MST and SPR assays, respectively. BMSpep-57 facilitates T cell function by in creasing IL-2 production in PBMCs .
    BMSpep-57
  • HY-P3143A
    BMSpep-57 hydrochloride

    		PD-1/PD-L1 Cancer
    BMSpep-57 hydrochloride is a potent and competitive macrocyclic peptide inhibitor of PD-1/PD-L1 interaction with an IC50 of 7.68 nM. BMSpep-57 hydrochloride binds to PD-L1 with Kds of 19 nM and 19.88 nM in MST and SPR assays, respectively. BMSpep-57 hydrochloride facilitates T cell function by in creasing IL-2 production in PBMCs .
    BMSpep-57 hydrochloride
  • HY-P10271
    RG7697

    		GLP Receptor Metabolic Disease
    RG7697 is a dual agonist for glucagon-like peptide receptor (GLP Receptor) and glucosedependent insulinotropic polypeptide receptor (GIPR), with EC50 of 5 and 3 pM, respectively. RG7697 exhibits antihyperglycemic property .
    RG7697
  • HY-P10341
    ZP3022

    		GCGR Metabolic Disease
    ZP3022 is a dual agonist of glucagon-like peptide-1 (GLP-1) and gastrin that has the ability to sustainably improve glycemic control. Additionally, ZP3022 can effectively increase β-cell mass, promote β-cell proliferation, and enhance the function of pancreatic islets. ZP3022 can be used in anti-diabetic research .
    ZP3022
  • HY-113560
    Plipastatin B1

    		Antibiotic Fungal Phospholipase Infection
    Plipastatin B1 is a lipopeptide antibiotic, an inhibitor of phospholipase A2 (PLA2), which has antifungal activity .
    Plipastatin B1
  • HY-P1162
    (d(CH2)51,Tyr(Me)2,Arg8)-Vasopressin

    SKF 100273

    		 Vasopressin Receptor Metabolic Disease
    (d(CH2)51,Tyr(Me)2,Arg8)-Vasopressin (SKF 100273) is a vasopressin V1 receptor selective antagonist .
    (d(CH2)51,Tyr(Me)2,Arg8)-Vasopressin
  • HY-P4895
    (d(CH2)51,Tyr(Me)2,Orn8)-Oxytocin

    		Oxytocin Receptor Neurological Disease
    (d(CH2)51,Tyr(Me)2,Orn8)-Oxytocin (OVT) is an oxytocin receptor antagonist. (d(CH2)51,Tyr(Me)2,Orn8)-Oxytocin can be used for the research of neurological disease .
    (d(CH2)51,Tyr(Me)2,Orn8)-Oxytocin
  • HY-P10272
    Rusfertide

    PTG-300

    		 Ferroportin Others
    Rusfertide is a peptide mimetic of natural hepcidin, which targets and degrades ferroportin, reduces serum iron and transferrin-saturation, and thus regulates the production of red blood cells. Rusfertide ameliorates the polycythemia vera, β-thalassemia and hereditary hemochromatosis .
    Rusfertide
  • HY-W040233B
    L-Lactic acid (sodium) (purity≥90%)
    5+ Cited Publications

    (S)-2-Hydroxypropanoic acid (sodium) (purity≥90%)

    		 Drug Intermediate Others
    Sodium (S)-2-hydroxypropanoate (Sodium L-lactate) (purity≥90%) is a buildiing block which can be used as a precursor for the production of the bioplastic polymer poly-lactic acid .
    L-Lactic acid (sodium) (purity≥90%)
  • HY-P10881
    Ganipatide

    		Peptide-Drug Conjugates (PDCs) Metabolic Disease
    Ganipatide is a 1-31-Glucose-dependent insulinotropic polypeptide. Ganipatide is promising for research of diabetes .
    Ganipatide
  • HY-132582A
    Tau ASO-12 (murine) (sodium)

    		Tau Protein Cancer
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) (sodium)
  • HY-W718145
    D-Mannose,6-dihydrogen phosphate (sodium)

    		Biochemical Assay Reagents Others
    D-Mannose,6-(dihydrogen phosphate) (sodium) is a class of biochemical reagents used in glycobiology research. Glycobiology studies the structure, synthesis, biology, and evolution of sugars. It involves carbohydrate chemistry, enzymology of glycan formation and degradation, protein-glycan recognition, and the role of glycans in biological systems. This field is closely related to basic research, biomedicine, and biotechnology .
    D-Mannose,6-dihydrogen phosphate (sodium)
  • HY-134442
    L-α-Phosphatidylinositol (liver, bovine) (sodium)

    		Biochemical Assay Reagents Others
    L-α-Phosphatidylinositol (liver, bovine) (sodium) is a biochemical reagent.
    L-α-Phosphatidylinositol (liver, bovine) (sodium)
  • HY-A0203A
    Pentosan Polysulfate (Sodium) (W/W 43%)

    		HIV Infection Inflammation/Immunology Cancer
    Pentosan Polysulfate Sodium is an orally bioavailable, semi-synthetic medication with anti-inflammatory and pro-chondrogenic properties. Pentosan Polysulfate Sodium also is a potent and selective anti-HIV agent. Pentosan Polysulfate Sodium is used for the treatment of interstitial cystitis [3].
    Pentosan Polysulfate (Sodium) (W/W 43%)
  • HY-N7755
    Estradiol 3-(β-D-Glucuronide) (sodium)

    		Estrogen Receptor/ERR Cancer
    Estradiol 3-(β-D-Glucuronide) sodium is the glucuronic acid derivative of estradiol (HY-B0141). Estradiol 3-(β-D-Glucuronide) sodium is radiolabeled for use in tumor imaging and biodistribution studies .
    Estradiol 3-(β-D-Glucuronide) (sodium)
  • HY-B2227B
    Lactate (sodium) (60% in water)
    25+ Cited Publications

    Lactic acid sodium

    		 Bacterial Metabolic Disease Cancer
    Lactate (60% in water) (Lactic acid) sodium is the product of glycogenolysis and glycolysis . Lactate sodium (60% in water) is an organic salt that is mainly used as a buffer and pH adjuster for injection solutions. Lactate sodium (60% in water) can be metabolized by the body into sodium bicarbonate, which in turn acts to increase the pH of the blood. Lactate sodium (60% in water) is used to improve metabolic acidosis and hypovolemic states. In terms of pharmaceutical preparations, Lactate sodium (60% in water) is often used in combination with sodium chloride, glucose, etc. to form normal saline or compound liquid intravenous injection [3] . Lactate sodium (60% in water) also has antimicrobial activity, which can be used as a food preservative .
    Lactate (sodium) (60% in water)
  • HY-158664
    2-Amino-ATP (sodium) solution (100mM)

    		Biochemical Assay Reagents DNA/RNA Synthesis Others
    2-Amino-ATP sodium solution (100mM) is a labeled modified deoxyoligonucleotide (dNTP) that can release pyrophosphate to produce fluorescence and has special applications in gene synthesis and sequencing .
    2-Amino-ATP (sodium) solution (100mM)
  • HY-135748A
    Poly (I:C):Kanamycin (1:1) (sodium)
    30+ Cited Publications

    		 Toll-like Receptor (TLR) Apoptosis Infection Cancer
    Poly (I:C):Kanamycin (1:1) sodium is an isometric complex of Poly (I:C) (HY-135748) and Kanamycin (HY-16566). Poly(I:C) sodium, a synthetic analog of double-stranded RNA, is a TLR3 and retinoic acid-inducible gene I receptor (RIG-I and b>MDA5) agonist. Poly(I:C) sodium can be used as a vaccine adjuvant to enhance innate and adaptive immune responses and induce apoptosis in cancer cells . Kanamycin is an orally active antibacterial agent (Gram-negative/positive bacteria) that inhibits translocation and causes miscoding by binding to the 70S ribosomal subunit. Kanamycin shows good inhibitory activity against Mycobacterium tuberculosis (susceptible and drug-resistant) and Klebsiella pneumoniae, and can be used in the research of tuberculosis and pneumonia [3] .
    Poly (I:C):Kanamycin (1:1) (sodium)
  • HY-P10563
    Noraramtide

    BHV-1100

    		 CD38 Cancer
    Noraramtide (BHV-1100) is an antibody recruitment molecule. Noraramtide can specifically bind to CD38 molecules to recruit natural killer (NK) cells. Noraramtide enhances the ability of NK cells to kill tumor cells through antibody-dependent cellular cytotoxicity (ADCC). This mechanism allows NK cells to more effectively recognize and eliminate tumor cells while avoiding mutual killing between NK cells. Noraramtide can be used for the study of autologous cancer immunity .
    Noraramtide
  • HY-W784574A
    dCTPαS sodium

    2'-Deoxycytidine-5'-O-1-thiotriphosphate (sodium)

    		 Biochemical Assay Reagents DNA/RNA Synthesis Others
    dCTPαS sodium is a labeled modified deoxyoligonucleotide (dNTP) that can release pyrophosphate to produce fluorescence and has special applications in gene synthesis and sequencing .
    dCTPαS sodium
  • HY-158715
    3'-ONH2-dTTP (sodium) solution (100mM)

    		Biochemical Assay Reagents DNA/RNA Synthesis Others
    3'-ONH2-dTTP sodium solution (100mM) is a labeled modified deoxyoligonucleotide (dNTP) that can release pyrophosphate to produce fluorescence and has special applications in gene synthesis and sequencing .
    3'-ONH2-dTTP (sodium) solution (100mM)
  • HY-W784573A
    dATPαS sodium

    2'-Deoxyadenosine 5'-O-1-thiotriphosphate (sodium)

    		 Biochemical Assay Reagents DNA/RNA Synthesis Others
    dATPαS sodium is a labeled modified deoxyoligonucleotide (dNTP) that can release pyrophosphate to produce fluorescence and has special applications in gene synthesis and sequencing .
    dATPαS sodium
  • HY-158712
    3'-ONH2-dATP (sodium) solution (100mM)

    		Biochemical Assay Reagents DNA/RNA Synthesis Others
    3'-ONH2-dATP sodium solution (100mM) is a labeled modified deoxyoligonucleotide (dNTP) that can release pyrophosphate to produce fluorescence and has special applications in gene synthesis and sequencing .
    3'-ONH2-dATP (sodium) solution (100mM)
  • HY-158713
    3'-ONH2-dGTP (sodium) solution (100mM)

    		Biochemical Assay Reagents DNA/RNA Synthesis Others
    3'-ONH2-dGTP sodium solution (100mM) is a labeled modified deoxyoligonucleotide (dNTP) that can release pyrophosphate to produce fluorescence and has special applications in gene synthesis and sequencing .
    3'-ONH2-dGTP (sodium) solution (100mM)
  • HY-158714
    3'-ONH2-dCTP (sodium) solution (100mM)

    		Biochemical Assay Reagents DNA/RNA Synthesis Others
    3'-ONH2-dCTP sodium solution (100mM) is a labeled modified deoxyoligonucleotide (dNTP) that can release pyrophosphate to produce fluorescence and has special applications in gene synthesis and sequencing .
    3'-ONH2-dCTP (sodium) solution (100mM)
  • HY-W854295
    Phosphatidylinositol-1,2-dioctanoyl sodium

    PtdIns-(1,2-dioctanoyl) (sodium)

    		 P-glycoprotein Cancer
    Phosphatidylinositol-1,2-dioctanoyl sodium significantly inhibits transmembrane P-gp transport in a reproducible, cell line-independent, and substrate-independent manner. Phosphatidylinositol-1,2-dioctanoyl sodium plays an important role in signal transduction and cell movement .
    Phosphatidylinositol-1,2-dioctanoyl sodium
  • HY-132609
    Patisiran sodium

    		Small Interfering RNA (siRNA) Transthyretin (TTR) Neurological Disease
    Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis [3].
    Patisiran sodium
  • HY-132608
    Inotersen sodium

    ISIS-420915 sodium

    		 Transthyretin (TTR) Neurological Disease
    Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy [3].
    Inotersen sodium
  • HY-108764
    Mipomersen sodium
    1 Publications Verification

    ISIS 301012

    		 Apolipoprotein HCV Metabolic Disease
    Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .
    Mipomersen sodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: